Month: February 2021

Double, double toil and trouble;
Fire burn and cauldron bubble

Everyone knows what a magic spell is. Say the words and things will happen. With the right incantation, you may see the future. Harm your foe. Ward off evil.

You generally need more than just words to make the magic happen. You may need a bubbling cauldron and some special ingredients.

Eye of newt and toe of frog,
wool of bat and tongue of dog.

I want to tell you about a modern charm that is, in every particular, a real and true spell of protection. It is written on a parchment small beyond seeing, rolled in fat, sprinkled with sugar and salt, then doused in an icy bath. Fragile and delicate, it must be handled with extreme care. Even gentle warmth will warp its power. But in the hands of an adept, it will shape the course of nations.

Cool it with a baboon’s blood,
Then the charm is firm and good.

When you are ready, the text is drawn from its freezing cask, streaming fog. An experienced acolyte sits near you and administers the charm, whispering to the very cells inside your body.

And this is how the spell begins: “M F V F L V L L P L V …”

Here is the rough translation:

Know this evil. Mark it well.
It comes for thee, in thee to dwell.
It comes to choke thee in thy sleep.
Choke it first, thy soul to keep.

Please hear me when I say that all of this is true. The spell is an mRNA vaccine, such as the ones created by Pfizer and Moderna to ward off the SARS-CoV-2 coronavirus, better known as COVID. It’s a description (literally “spelled out”) of part of the virus. In magical terms, it’s the tooth of the dog that might bite you. The letters in the text above are from the protein sequence of the very spike protein that punches a hole in your throat. These are the fingers that prize open the windows of your lungs. “Corona” means crown, and these are the spikes on the crown. This is what the vaccine is instructing your immune system to beware of.

So far, I’ve been using the old language of magic. Here is a more modern description. It still has a lovely incantation-like bounce to it, don’t you think?

The Moderna COVID-19 Vaccine (mRNA-1273) is an mRNA vaccine candidate against the novel coronavirus SARS-CoV-2 encoding for a prefusion stabilized form of the spike (S) protein, a class I fusion glycoprotein analogous to influenza haemagglutinin, respiratory syncytial virus (RSV) fusion glycoprotein (F) and human immunodeficiency virus gp160 (Env), and which is the major surface protein on the coronavirus virion and the primary target for neutralizing antibodies.

I want to give you a glimpse of how the message is conveyed. Because it really is spelled out like text on tape. And incidentally, this is why the technique holds great promise for the future. We don’t need to grow our vaccines anymore. We can just type them on a tiny scroll. All you need is a nanoscopic typewriter with a keyboard four letters wide.

The starting sequence in mRNA looks like this.

atgtttgtttttcttgttttattgccactagtc ...

This message gets encoded by your own cells to build a protein out of amino acids.

atg = M = Methionine
ttt = F = Phenylalanine
gtt = V = Valine
ttt = F = Phenylalanine
ctt = L = Leucine
gtt = V = Valine
tta = L = Leucine
ttg = L = Leucine
cca = P = Proline
cta = L = Leucine
gtc = V = Valine
...

This is, of course, just the beginning of a longer sequence that eventually forms the dagger that punches into your chest. Here is the complete sequence. Or you may prefer the graphical version.

And finally, “rolled in fat and sprinkled with sugar and salt”? It’s true. Look at the ingredient list for the Pfizer vaccine: A Breakdown of the Ingredients in the COVID Vaccines. Everything is there for a reason. The mRNA fragments are rolled into little fatty lipid cells to keep them safe. Salts help match the pH, and sugar stabilizes the shape.

And now the charm is nearly ready…

Double, double toil and trouble;
Fire burn and cauldron bubble

UPDATE: I made a guess here as to exactly what sequence they would use for the vaccine. But the actual sequence has now been published. See How Do You Spell Vaccine?

Find even more information here: Reverse Engineering the BioNTech/Pfizer Vaccine.

Giraffes have a look: brown puzzle blocks edged with white. Zebras are even more iconic, with those bold contrasty stripes. I don’t know how much good it does them on the Serengeti, but the branding is magnificent.

The interesting question is: how do you paint a zebra? How does a zebra come by its look? By going to the animal print store and searching the Zs? Visiting their favorite stripe salon for a new do? No, they get those stripes at the same store that sold you your fingerprints. The mom store. It’s in the genes. But saying it’s in the genes doesn’t really tell us much. How does it work?

Suppose you want your dining room done up in realistic zebra stripes. Your mom being human, you can’t do the zebra trick. So you go shopping for a quality zebra wallpaper print. That’s a challenge, but let’s assume you find it. Then there are other problems. First, it’s hard to get the paper to line up perfectly so the seams all fit. Next, you’ll notice repeating patterns in your wallpaper, because that’s how wallpaper works. Once you notice it, it will drive you crazy. But real zebras never have this problem. Their patterning is unique, and it shifts perfectly to suit the contours of their body. How?

The answer is that it’s a procedural pattern. There’s a program that paints zebra-ness in just the right way onto the canvas that is Mr. Zebra. And now, through the magic of neural networks, we can do it too. Check out this paper on self-organizing textures from some folks at Google.

Self-Organising Textures

Check it out! It’s mesmerizing, and there are dozens of patterns to play with, including, naturally, the iconic zebra. And since it’s algorithmic, we can give it different conditions. This, for example, is what zebra stripes look like at the south pole.

In the future, everything will be procedural. Architecture, silverware, clothing. If you want zebra stripes in your dining room, all you’ll need to do is specify exactly the area that you want to cover. Then you can just drop a zebra pattern seed in the lower left corner and wait. But we can do the zebra one better. If, next week, you decide it should be a giraffe-themed dining experience, just drop in a giraffe seed.

We’re starting to get a better idea how life cooks up, as Darwin says, “endless forms most beautiful.” I’ll leave you with a link to work by Sage Jenson, who might be one of the first biological artists. These simulations, originally inspired by slime mold self-organization, are essentially living canvases.

View this post on Instagram

A post shared by sage↪️ (@mxsage)

This video is a beautiful visualization of how life finds a way to thrive in adverse circumstances. It provides some insight into what’s going on with the coronavirus as it mutates. The key point is that we think of vaccination as extinguishing a virus, when it’s really just one part of an endless back and forth tennis match. We’re continuously learning from each other and training each other. It never stops.

In the video, an E. coli culture has been placed at the ends of an enormous plate of agar. You can see some some stripes in it. Each stripe is more poisonous than the one before it. The bacterial colony starts in a happy zone with no poison. It grows quickly until it hits the first poison strip (antibiotic). It looks like it’s stalled out, but in a few locations, the bacteria figure out a way (they mutate) to defeat the effect of the poison, and you see another breakout. All the “children” who continue on are descended from the clever bacterium that cut the hole in the fence.

This process is repeated three more times. The progress of the colony is stymied… until somebody cuts through the next fence, and the relentless march continues. In other words, we may think we’re making a prison for bacteria, but it’s more useful to think of it as a training center for ninja commando bacteria!

The superimposed colored lines show branching trees of inheritance. The bacteria that reach the red “end zone” have had to adapt to life-threatening poison multiple times. Is their appearance in a sea of toxic sludge miraculous or inevitable? It’s hard to know ahead of time, but there they are. Life finds a way.

Here is the video. This is not a notional diagram or cartoon. You’re watching genuine evolution, the engine of life’s variety, happen before your eyes. There it is! If Darwin believed in heaven and was there right now, he’d be smiling at this. But I think he’s just dead. Anyway, press “play” already…

Here is a similar-looking tree diagram for the coronavirus, as maintained on Nextstrain.org. As before, each branch represents a successful mutation. Maybe it was in response to some stress, or maybe it was just random. But from just a few virus particles on the left side comes a fantastic woolly forest of viral variation on the right. It never stops.

We now have the magic goggles that let us watch evolution like a spectator sport. Nextstrain even has this fascinating “market share” diagram. Some strains do better. Some do worse. The ones that do better get to make more copies. It’s as simple, and as complicated, as that.

And it never ever stops.

Welcome to February, and happy 139th birthday James Joyce!

Groundhog Day is a cross-quarter day, halfway from solstice to equinox. I think of the quarter days (solstices and equinoxes) as being pivot days for heat, and cross-quarter days as being pivot days for light. So it starts getting really cold in late December, but it takes a while for you to truly notice that the days are getting longer. It takes, roughly speaking, until now. Groundhog Day can be celebrated as the return of the light. It’s still cold, but from now on winter is fighting a losing battle. It’s on its back foot. You can only go halfway into a tunnel. After that, you’re going out of it. That’s where we are. Heading out of winter.

In a somewhat larger sense, we might say that we’re on our way out of a number of unpleasant ordeals. We’re still in the tunnel. But hey! Breathe a little easier. We’re on the way out. The light is returning.

A new form of manufacturing is finally bearing fruit. The old form of manufacturing is the assembly line. The very phrase “assembly line” is synonymous with rapid and efficient manufacturing. But soon we’ll do much better. The funny thing is that the new form of manufacturing is the most ancient of all: gestation. Call it Womb 2.0.

You can call it 3D printing if you prefer, but I think that misses the biggest point here. We’re actually moving forward to (and back to) a biological model. Consider the cow. All she needs is some grass (and a small DNA download) and she can build you another cow. All the articulation, all the value-add, is done in utero, on site. She doesn’t have to coordinate a far-flung network of horn suppliers, udder contractors, and hoof makers. She doesn’t manage warehoused inventories of tongue and tail sub-assemblies. She doesn’t even need a lot of space.

cow + cheap local materials + digital spec + time = new cow

You might think, compared to assembly lines, that this biological construction model can’t scale. Except for the fact that it obviously can. Every farm product you’ve ever consumed was first created at the scale of one animal or plant at a time. Every egg came from exactly one chicken. It’s a different kind of scaling from Ford’s River Rouge Complex, but it does scale. And it scales in the simplest possible way. Need more stuff? Make more wombs. Need different stuff? Give the wombs different instructions.

Scale works in the other direction, too. Wombs have the ability to scale down in a way that assembly lines don’t. You would never build an assembly line to make a dozen items. You need to know that you’re going to build thousands of units. This requires you to make enormous bets on products. But with a womb-based construction, your cost floor is much lower. You can make small bets and only scale up when it pays off. The flexibility this gives you is breathtaking. You can tweak designs and optimize in a way that is truly biological, with small variations that will propagate if successful.

Plenty has been written about 3D printing. The reason I’m especially excited about 21st century gestation right now is because I’m seeing a critical mass of real businesses on the verge of making real money. What we’ve talked about is happening.

• Mighty Buildings prints small buildings with a UV-cured resin.
• Relativity Space prints rockets with the world’s largest metal printer.
• Czinger prints the 21C hypercar.

All these companies use a tiny amount of manufacturing floor space relative to their old-school alternatives. They work with relatively simple raw material inputs, and they can be modulated rapidly by software.

womb + raw material + digital spec + time = new product (=> profit!)

I think it’s worthwhile to think of this process not as 3D printing, but as gestation. We’re finally learning from the master.

The cow has much to teach us.