Double, double toil and trouble;
Fire burn and cauldron bubble
Everyone knows what a magic spell is. Say the words and things will happen. With the right incantation, you may see the future. Harm your foe. Ward off evil.
You generally need more than just words to make the magic happen. You may need a bubbling cauldron and some special ingredients.
Eye of newt and toe of frog,
wool of bat and tongue of dog.
I want to tell you about a modern charm that is, in every particular, a real and true spell of protection. It is written on a parchment small beyond seeing, rolled in fat, sprinkled with sugar and salt, then doused in an icy bath. Fragile and delicate, it must be handled with extreme care. Even gentle warmth will warp its power. But in the hands of an adept, it will shape the course of nations.
Cool it with a baboon’s blood,
Then the charm is firm and good.
When you are ready, the text is drawn from its freezing cask, streaming fog. An experienced acolyte sits near you and administers the charm, whispering to the very cells inside your body.
And this is how the spell begins: “M F V F L V L L P L V …”
Here is the rough translation:
Know this evil. Mark it well.
It comes for thee, in thee to dwell.
It comes to choke thee in thy sleep.
Choke it first, thy soul to keep.
Please hear me when I say that all of this is true. The spell is an mRNA vaccine, such as the ones created by Pfizer and Moderna to ward off the SARS-CoV-2 coronavirus, better known as COVID. It’s a description (literally “spelled out”) of part of the virus. In magical terms, it’s the tooth of the dog that might bite you. The letters in the text above are from the protein sequence of the very spike protein that punches a hole in your throat. These are the fingers that prize open the windows of your lungs. “Corona” means crown, and these are the spikes on the crown. This is what the vaccine is instructing your immune system to beware of.
So far, I’ve been using the old language of magic. Here is a more modern description. It still has a lovely incantation-like bounce to it, don’t you think?
The Moderna COVID-19 Vaccine (mRNA-1273) is an mRNA vaccine candidate against the novel coronavirus SARS-CoV-2 encoding for a prefusion stabilized form of the spike (S) protein, a class I fusion glycoprotein analogous to influenza haemagglutinin, respiratory syncytial virus (RSV) fusion glycoprotein (F) and human immunodeficiency virus gp160 (Env), and which is the major surface protein on the coronavirus virion and the primary target for neutralizing antibodies.
I want to give you a glimpse of how the message is conveyed. Because it really is spelled out like text on tape. And incidentally, this is why the technique holds great promise for the future. We don’t need to grow our vaccines anymore. We can just type them on a tiny scroll. All you need is a nanoscopic typewriter with a keyboard four letters wide.
The starting sequence in mRNA looks like this.
atgtttgtttttcttgttttattgccactagtc ...
This message gets encoded by your own cells to build a protein out of amino acids.
atg = M = Methionine ttt = F = Phenylalanine gtt = V = Valine ttt = F = Phenylalanine ctt = L = Leucine gtt = V = Valine tta = L = Leucine ttg = L = Leucine cca = P = Proline cta = L = Leucine gtc = V = Valine ...
This is, of course, just the beginning of a longer sequence that eventually forms the dagger that punches into your chest. Here is the complete sequence. Or you may prefer the graphical version.
And finally, “rolled in fat and sprinkled with sugar and salt”? It’s true. Look at the ingredient list for the Pfizer vaccine: A Breakdown of the Ingredients in the COVID Vaccines. Everything is there for a reason. The mRNA fragments are rolled into little fatty lipid cells to keep them safe. Salts help match the pH, and sugar stabilizes the shape.
And now the charm is nearly ready…
Double, double toil and trouble;
Fire burn and cauldron bubble
UPDATE: I made a guess here as to exactly what sequence they would use for the vaccine. But the actual sequence has now been published. See How Do You Spell Vaccine?
Find even more information here: Reverse Engineering the BioNTech/Pfizer Vaccine.