A Modern Magical Spell

Double, double toil and trouble;
Fire burn and cauldron bubble

Everyone knows what a magic spell is. Say the words and things will happen. With the right incantation, you may see the future. Harm your foe. Ward off evil.

You generally need more than just words to make the magic happen. You may need a bubbling cauldron and some special ingredients.

Eye of newt and toe of frog,
wool of bat and tongue of dog.

I want to tell you about a modern charm that is, in every particular, a real and true spell of protection. It is written on a parchment small beyond seeing, rolled in fat, sprinkled with sugar and salt, then doused in an icy bath. Fragile and delicate, it must be handled with extreme care. Even gentle warmth will warp its power. But in the hands of an adept, it will shape the course of nations.

Cool it with a baboon’s blood,
Then the charm is firm and good.

When you are ready, the text is drawn from its freezing cask, streaming fog. An experienced acolyte sits near you and administers the charm, whispering to the very cells inside your body.

And this is how the spell begins: “M F V F L V L L P L V …”

Here is the rough translation:

Know this evil. Mark it well.
It comes for thee, in thee to dwell.
It comes to choke thee in thy sleep.
Choke it first, thy soul to keep.

Please hear me when I say that all of this is true. The spell is an mRNA vaccine, such as the ones created by Pfizer and Moderna to ward off the SARS-CoV-2 coronavirus, better known as COVID. It’s a description (literally “spelled out”) of part of the virus. In magical terms, it’s the tooth of the dog that might bite you. The letters in the text above are from the protein sequence of the very spike protein that punches a hole in your throat. These are the fingers that prize open the windows of your lungs. “Corona” means crown, and these are the spikes on the crown. This is what the vaccine is instructing your immune system to beware of.

So far, I’ve been using the old language of magic. Here is a more modern description. It still has a lovely incantation-like bounce to it, don’t you think?

The Moderna COVID-19 Vaccine (mRNA-1273) is an mRNA vaccine candidate against the novel coronavirus SARS-CoV-2 encoding for a prefusion stabilized form of the spike (S) protein, a class I fusion glycoprotein analogous to influenza haemagglutinin, respiratory syncytial virus (RSV) fusion glycoprotein (F) and human immunodeficiency virus gp160 (Env), and which is the major surface protein on the coronavirus virion and the primary target for neutralizing antibodies.

I want to give you a glimpse of how the message is conveyed. Because it really is spelled out like text on tape. And incidentally, this is why the technique holds great promise for the future. We don’t need to grow our vaccines anymore. We can just type them on a tiny scroll. All you need is a nanoscopic typewriter with a keyboard four letters wide.

The starting sequence in mRNA looks like this.

atgtttgtttttcttgttttattgccactagtc ...

This message gets encoded by your own cells to build a protein out of amino acids.

atg = M = Methionine
ttt = F = Phenylalanine
gtt = V = Valine
ttt = F = Phenylalanine
ctt = L = Leucine
gtt = V = Valine
tta = L = Leucine
ttg = L = Leucine
cca = P = Proline
cta = L = Leucine
gtc = V = Valine
...

This is, of course, just the beginning of a longer sequence that eventually forms the dagger that punches into your chest. Here is the complete sequence. Or you may prefer the graphical version.

And finally, “rolled in fat and sprinkled with sugar and salt”? It’s true. Look at the ingredient list for the Pfizer vaccine: A Breakdown of the Ingredients in the COVID Vaccines. Everything is there for a reason. The mRNA fragments are rolled into little fatty lipid cells to keep them safe. Salts help match the pH, and sugar stabilizes the shape.

And now the charm is nearly ready…

Double, double toil and trouble;
Fire burn and cauldron bubble

UPDATE: I made a guess here as to exactly what sequence they would use for the vaccine. But the actual sequence has now been published. See How Do You Spell Vaccine?

Grow Your Wallpaper

Giraffes have a look: brown puzzle blocks edged with white. Zebras are even more iconic, with those bold contrasty stripes. I don’t know how much good it does them on the Serengeti, but the branding is magnificent.

The interesting question is: how do you paint a zebra? How does a zebra come by its look? By going to the animal print store and searching the Zs? Visiting their favorite stripe salon for a new do? No, they get those stripes at the same store that sold you your fingerprints. The mom store. It’s in the genes. But saying it’s in the genes doesn’t really tell us much. How does it work?

Suppose you want your dining room done up in realistic zebra stripes. Your mom being human, you can’t do the zebra trick. So you go shopping for a quality zebra wallpaper print. That’s a challenge, but let’s assume you find it. Then there are other problems. First, it’s hard to get the paper to line up perfectly so the seams all fit. Next, you’ll notice repeating patterns in your wallpaper, because that’s how wallpaper works. Once you notice it, it will drive you crazy. But real zebras never have this problem. Their patterning is unique, and it shifts perfectly to suit the contours of their body. How?

The answer is that it’s a procedural pattern. There’s a program that paints zebra-ness in just the right way onto the canvas that is Mr. Zebra. And now, through the magic of neural networks, we can do it too. Check out this paper on self-organizing textures from some folks at Google.

Self-Organising Textures

Check it out! It’s mesmerizing, and there are dozens of patterns to play with, including, naturally, the iconic zebra. And since it’s algorithmic, we can give it different conditions. This, for example, is what zebra stripes look like at the south pole.

In the future, everything will be procedural. Architecture, silverware, clothing. If you want zebra stripes in your dining room, all you’ll need to do is specify exactly the area that you want to cover. Then you can just drop a zebra pattern seed in the lower left corner and wait. But we can do the zebra one better. If, next week, you decide it should be a giraffe-themed dining experience, just drop in a giraffe seed.

We’re starting to get a better idea how life cooks up, as Darwin says, “endless forms most beautiful.” I’ll leave you with a link to work by Sage Jenson, who might be one of the first biological artists. These simulations, originally inspired by slime mold self-organization, are essentially living canvases.

Visualizing Viral Mutation

This video is a beautiful visualization of how life finds a way to thrive in adverse circumstances. It provides some insight into what’s going on with the coronavirus as it mutates. The key point is that we think of vaccination as extinguishing a virus, when it’s really just one part of an endless back and forth tennis match. We’re continuously learning from each other and training each other. It never stops.

In the video, an E. coli culture has been placed at the ends of an enormous plate of agar. You can see some some stripes in it. Each stripe is more poisonous than the one before it. The bacterial colony starts in a happy zone with no poison. It grows quickly until it hits the first poison strip (antibiotic). It looks like it’s stalled out, but in a few locations, the bacteria figure out a way (they mutate) to defeat the effect of the poison, and you see another breakout. All the “children” who continue on are descended from the clever bacterium that cut the hole in the fence.

This process is repeated three more times. The progress of the colony is stymied… until somebody cuts through the next fence, and the relentless march continues. In other words, we may think we’re making a prison for bacteria, but it’s more useful to think of it as a training center for ninja commando bacteria!

The superimposed colored lines show branching trees of inheritance. The bacteria that reach the red “end zone” have had to adapt to life-threatening poison multiple times. Is their appearance in a sea of toxic sludge miraculous or inevitable? It’s hard to know ahead of time, but there they are. Life finds a way.

Here is the video. This is not a notional diagram or cartoon. You’re watching genuine evolution, the engine of life’s variety, happen before your eyes. There it is! If Darwin believed in heaven and was there right now, he’d be smiling at this. But I think he’s just dead. Anyway, press “play” already…

Here is a similar-looking tree diagram for the coronavirus, as maintained on Nextstrain.org. As before, each branch represents a successful mutation. Maybe it was in response to some stress, or maybe it was just random. But from just a few virus particles on the left side comes a fantastic woolly forest of viral variation on the right. It never stops.

We now have the magic goggles that let us watch evolution like a spectator sport. Nextstrain even has this fascinating “market share” diagram. Some strains do better. Some do worse. The ones that do better get to make more copies. It’s as simple, and as complicated, as that.

And it never ever stops.

Happy Groundhog Day!

Welcome to February, and happy 139th birthday James Joyce!

Groundhog Day is a cross-quarter day, halfway from solstice to equinox. I think of the quarter days (solstices and equinoxes) as being pivot days for heat, and cross-quarter days as being pivot days for light. So it starts getting really cold in late December, but it takes a while for you to truly notice that the days are getting longer. It takes, roughly speaking, until now. Groundhog Day can be celebrated as the return of the light. It’s still cold, but from now on winter is fighting a losing battle. It’s on its back foot. You can only go halfway into a tunnel. After that, you’re going out of it. That’s where we are. Heading out of winter.

Onto each head, a little sky must fall. So always bring a hard hat.

In a somewhat larger sense, we might say that we’re on our way out of a number of unpleasant ordeals. We’re still in the tunnel. But hey! Breathe a little easier. We’re on the way out. The light is returning.

Construction by Gestation

A new form of manufacturing is finally bearing fruit. The old form of manufacturing is the assembly line. The very phrase “assembly line” is synonymous with rapid and efficient manufacturing. But soon we’ll do much better. The funny thing is that the new form of manufacturing is the most ancient of all: gestation. Call it Womb 2.0.

You can call it 3D printing if you prefer, but I think that misses the biggest point here. We’re actually moving forward to (and back to) a biological model. Consider the cow. All she needs is some grass (and a small DNA download) and she can build you another cow. All the articulation, all the value-add, is done in utero, on site. She doesn’t have to coordinate a far-flung network of horn suppliers, udder contractors, and hoof makers. She doesn’t manage warehoused inventories of tongue and tail sub-assemblies. She doesn’t even need a lot of space.

cow + cheap local materials + digital spec + time = new cow

You might think, compared to assembly lines, that this biological construction model can’t scale. Except for the fact that it obviously can. Every farm product you’ve ever consumed was first created at the scale of one animal or plant at a time. Every egg came from exactly one chicken. It’s a different kind of scaling from Ford’s River Rouge Complex, but it does scale. And it scales in the simplest possible way. Need more stuff? Make more wombs. Need different stuff? Give the wombs different instructions.

Scale works in the other direction, too. Wombs have the ability to scale down in a way that assembly lines don’t. You would never build an assembly line to make a dozen items. You need to know that you’re going to build thousands of units. This requires you to make enormous bets on products. But with a womb-based construction, your cost floor is much lower. You can make small bets and only scale up when it pays off. The flexibility this gives you is breathtaking. You can tweak designs and optimize in a way that is truly biological, with small variations that will propagate if successful.

Plenty has been written about 3D printing. The reason I’m especially excited about 21st century gestation right now is because I’m seeing a critical mass of real businesses on the verge of making real money. What we’ve talked about is happening.

This is Relativity’s marketing pitch. That’s the rocket printer on the right.

All these companies use a tiny amount of manufacturing floor space relative to their old-school alternatives. They work with relatively simple raw material inputs, and they can be modulated rapidly by software.

womb + raw material + digital spec + time = new product (=> profit!)

I think it’s worthwhile to think of this process not as 3D printing, but as gestation. We’re finally learning from the master.

The cow has much to teach us.

Toilet Seats and Cardboard Saws

I love my toilet seat.

Some product are so well designed that they bring delight every single time you use them. My toilet seat is a slow-close toilet seat. That means I don’t have to worry about it slamming down with an ear-splitting BANG! I don’t have to lower it with anxious care. Just give it a tip and it floats … gracefully … downward like an autumn leaf dropping noiselessly onto still water. I always HATED that bang, so it makes me happy every time, knowing blissful silence will prevail.

I know there’s nothing especially novel or groundbreaking about my slow-close toilet seat. You probably have one too. I only mention it as an example of delightful design. But now I’m going to give you some news you really can use.

It appears small and friendly, but if you were a box you’d be terrified right now.

Friends, this is the Canary Corrugated Cardboard Cutter, designed by a Japanese super genius and shipped to your door for less than ten dollars. Of course, it’s only useful if you happen to have a lot corrugated cardboard sitting around. What’s that, my friend? You DO have a lot of corrugated cardboard sitting around? Because every single thing you’ve purchased since last March, from your yoga mat to individual slices of cheese, comes packaged in corrugated cardboard? And your garage is stacked from floor to ceiling with the stuff?

In that case, my friend, this product is going to change your life. It makes me blush to pitch it like a copywriter in heat, but I’m only saying this because I want my joy to be your joy. This cutter has, as of this writing, 2402 five-star ratings on Amazon. In the comments people have written love poetry to it.

In my pre-Canary days, my wife would ask me to break down boxes for recycling and I would dread the chore. Even with serious box-cutter razor blades, it was slow work, stressful on the hands and wrists. Not to mention the ever-present threat of slicing an artery. The folks at the recycling center frown on cardboard that has been dowsed with jets of hot blood.

The Canary is so cleverly designed that it presents no danger of blood-letting, yet it is effortlessly lethal to the box. I wield it like a tiny lightsaber, burning through cardboard sinews and joints. Then I stare at it in admiration, wondering how it manages its work so well. It is almost a pleasure to dispatch a big box into the tasty flakes that my recycling bin can ingest. As with the toilet seat, an erstwhile source of stress recedes and you are deposited into a quieter, a brighter world. A saner world. Pray enjoy it before you become accustomed!

Buy it here: Canary Corrugated Cardboard Cutter

The box it ships in will be the last box you open without it.

Open Source Making, Open Source Maintaining

I enjoyed this Long Now talk by open source researcher Nadia Eghbal. If you can’t be bothered to read her book, here’s a good summary of what she’s learned.

Working in Public

TL;DR: Nobody got into software because they love maintenance.

Related: Nobody ever became a teacher because they love grading.

I love one of the stories she ends with. She quotes someone who says that being a maintainer is like the movie “Good Will Hunting”, but in reverse: you start out as a respected genius, and you end up as a janitor who fights with strangers.

One of the ideas she mentions is that “maintainer” is not such a great word. We might be better off using a word like “steward”, something that acknowledges the community-centric work of dealing with lots of people to manage a valuable public resource.

The distinction between making and maintaining gets at the point that open source is really two things. One is a static artifact. Here it is. You can have it. It’s my gift to you. The other is a service. I’m using your code, and I expect you to keep it up-to-date, fix any bugs, add my favorite features, and so on. We perceive the code as an object, but we consume it as a service. Intrinsic motivation is sufficient for the giving of the gift. That’s an event. But providing a service is a job, an ongoing obligation. And that demands extrinsic motivation. I didn’t sign up for that. For that, you need to pay me.

I don’t mind throwing you a party, but I won’t pump your gas.

Playing God

A common criticism invoked against new technology is this:

“We shouldn’t play God.”

It’s hard to know what to make of this. It seems to be God’s exclusive role to do the things currently beyond our ability. Then when we figure out how to do them, we’re, what? Putting God out of a job? What exactly is God’s job? More than anything, this statement is a generic push back against anything new, with a faux-pious relish.

Humans can fly now? We shouldn’t be playing God. Walking on the moon? Don’t play God. Vaccines? Test tube babies? Tasty GMO tomatoes? Only God gets to do that. Ski lifts? Instagrams filters? Nonstick cookware? God is gonna be pissed.

Any time we figure out how to do something new, we’re playing God. At least, up until the moment that the disorienting new thing becomes the boring old thing.

I wondered: when did this trend start? Who was the first person to level this critique? This is the image that came into my mind.

It’s true enough that we need to exercise discretion with our technological offspring. But simple rejection of the possible doesn’t get us anywhere. I think Stewart Brand, writing in the 1968 edition of the Whole Earth Catalog, has the last word on the subject: “We are as gods and might as well get good at it.”

Simulators Have Come a Long Way

When I was in high school, I got a summer job working at NASA’s Langley Research Center in Hampton, Virginia. Being young and useless, I didn’t do much for NASA. But they sure got me fired up for a career in aerospace. As a young airplane geek I got to see all kinds of cool stuff. One that I particularly remember for its gee-whiz factor was the old Redifon flight simulator. It was huge. Was it huge because it used a giant vacuum-tube computer? No. It was huge because it featured a giant map stuck to a wall! Think of it as an enormous model train landscape turned on its side. With no trains. And an aircraft carrier.

Redifon Flight Simulator

I must have seen it just before it was torn down, because it was still capable of running. But even then it was clearly on the way out. This was the awkward period when the new digital simulations weren’t yet very good even though the old mechanical simulators were on their last legs.

Look at that picture! The terrain is a hand-painted map. The visuals for the cockpit come from a video camera with a periscope attachment that “flies” over the landscape. You actually had to worry about flying the periscope into the ground or a building and damaging the simulator. With a scale of 2000:1, they could pack a lot of detail into the landscape. But the pilots were obviously pretty constrained, so I think it was only useful for take-offs, landings, and other airport operations.

I was thinking about this overlap that I had with the Elder Days because I recently (along with half the rest of the world) bought a copy of Microsoft’s Flight Simulator 2020. You just can’t believe how big and beautiful and complete this simulator is. It has every airport in the world, dozens of airplanes perfectly rendered inside and out, sumptuous clouds, and accurate time-of-day lighting. Moving traffic on the ground! Wandering herds of wildebeest! Migrating flocks of flamingos! It’s hard to know where they can go from here. It just seems like they’ve solved flight simulation once and for all.

Microsoft Flight Simulator 2020

But they’re not quite done. Now what I’d like them to do is model, inside FS2020, the old Redifon terrain map, sideways aircraft carrier and all. Kind of like making an iPhone app of an abacus. Somebody out there has to want to do this…

Freedom from FOMO

I can’t help but notice, dear reader, that you’re having a hard time filling your SocialTwitterInstaBook feed with fabulousness. But you’re in good company. It’s hard to do these days. And as a long time sufferer of FOMO (the Fear of Missing Out), I want to personally thank you. It means I’m not falling behind.

It turns out, I mostly don’t mind staying home and being boring, so long as you’re forced to do more or less the same thing. You can’t fly to Mallorca without me. You can’t meet Lin Manuel Miranda at that amazing charity event you run. You can’t even sit near the Lieutenant Governor at Chez Okay, the pretty good French restaurant at the corner of Fourth and Lame. That would’ve made a sweet Instagram selfie, n’est-ce pas?

Not this year, my friend…

In the old days, if you did any of those things, or rather, if I had the misfortune to learn about you doing any of those things, then I would feel bad. I would feel bad, because you would be AHEAD and I would be BEHIND. I don’t like to be so blunt about it, but there it is. My lizard brain, despite all my protests to the contrary, cares about these things. Hey, look, I didn’t invent the brain stem. I just have to wear one every day.

You used to be Instagramming glorious sunset photos from Greece. But where are you now, huh? Stuck at home. Watching Netflix and eating way too many powdered donuts, just like me. What’s that? You’re watching operas, learning Italian, and cooking gourmet meals? Dammit! Don’t they have some kind of quarantine for that too?