Rambles Blog at Star Chamber

Strava has been wildly successful at getting people to surrender their privacy in the name of bragging about fitness. You log your activity on the Strava website, and from this you can make personalized maps. You can even share this information up into a global heatmap database, from which Strava can show you where EVERYBODY has been running and biking and snowshoeing and paragliding and dolphin-riding and so on.

It’s a lot of fun to play around with. Shown below, we’re zoomed in on Cambridge and Boston. It’s no surprise that busy streets are busy, but I like how you can see exactly where the gaps are under the Harvard Bridge. The Charles River looks like a highway. Which, for the purposes of sport (and fish), it is.

I was jealous of these personal activity maps, but not jealous enough to spend the money on Strava. That was when I remembered something important, something that I try to remind myself on a regular basis: whenever you imagine a potential app or web service, you cause somebody to retroactively make it for you. That is to say, your idea isn’t original, so someone has already done it for you. All you have to do is say “All-seeing Google, show me the thing that does X.”

As in the sentence: “Show me the site that will let me make my own Strava-like heatmaps for free.”

I know this is kind of obvious, but sometimes I forget to actually make a pointed request for something that is vaguely floating around in my mind. I’m kind of thinking about it (“gee, that Strava heatmap is cool…”), but I don’t articulate the specific question. This means that the app never gets retroactively created by internet elves on my behalf. You see how it works? The magic never happens.

Anyway, I was not disappointed. I was led very quickly t0 dérive by Erik Price. It’s free! It’s open source (MIT license)! It’s very good, and it works like a charm. Huzzah! How I love the new millennium. And thank you, Erik.

You just bring your own GPX files to the dérive website, and then drag them onto the browser. All the work happens in the browser, so you’re not actually sending any of the files back up to the site.

This pandemic has given me a lot of time to walk around my hometown, and my completionist tendencies coupled with a nice route-planning app (Footpath) have given me the motivation to explore.

How it started:

How it’s going:

You’d be amazed how many roads are close to you that you’ve never been on.

Here is a picture of two different factories that do the same thing: turn atmospheric nitrogen into ammonia.

The one on the left is a gigantic Haber process plant. It requires fantastic amounts of heat and pressure to do its work. Plants like this consume 3-5% of the entire world’s natural gas output. The one on the right is an enzyme: nitrogenase. It can do its work in the roots of the clover growing in your front yard, all with very little risk of an explosive industrial accident.

This vignette shows one of the biggest lessons that biology has to teach us: how to do useful chemistry with much less effort. Which has all kinds of benefits, as you can imagine.

People hear the terms “biotech” and “synthetic biology” and it’s no surprise that the pharmaceutical industry is what springs to mind. After all, we live in the shadow of The Virus. I don’t want to diminish the miracles being worked by the mRNA hackers at Moderna and Pfizer, but I do want to point how much synthetic biology is already doing for us in non-medical settings. This article about Frances Arnold provides a couple of real world examples.

Nobelist Frances Arnold Is Nudging Nature To Make Your World Greener, One Small Evolution At A Time

Here’s a laundry-related story.

Up to 80% of your washing machine’s energy use comes from heating the water. But cold water wash is the way to go these days, thanks to engineered enzymes. Your laundry detergent contains eight or more enzymes, all designed to do the work that hot water used to. So do yourself and the planet a favor: set your wash cycle to “cold” and let engineered enzymes save energy and expense with every load.

I like this example because it highlights the same big machine/small machine dichotomy I described above. You can do a lot of work at high heat with a big machine (the washer), or you can do much less work in cold water with many small machines (enzymatic molecules). It seems like a cute example, but it’s real and it matters. There are many more stories like it.

So set that cycle to cold! One day we’ll look back and laugh at how profligate we were with our energy. Or maybe we’ll cry. Or maybe we won’t be here because we played with fire for too long.

Oooh, that got dark. Let’s go with laugh.

I came across a cartoon the other day. Maybe you’ve seen it too. This is my re-drawn version of it, to give you the general idea. A guy pulls up to a burger place in a big gas-guzzling car. Smoke pours from the tailpipe. He’s about to take his order, but then he draws back: “No plastic bags for me. I care about the environment!”

Big Car Burger Guy is such a dope! He’s an easy target for ridicule. But ultimately I think making fun of him is unhelpful. I want Big Car Burger Guy to swear off plastic. Good for you, Big Car Burger Guy! If that’s all he can do today, then that’s okay with me. He’s moving in the right direction. I hope he’ll do more tomorrow, but I guarantee you that if I make fun of him today, it won’t lead to a better outcome tomorrow.

Let’s go back to the cartoon. It’s funny because if Big Car Burger Guy really cared about the environment, he would… what? Well, let’s see. He wouldn’t drive a car powered with fossil fuels. Actually, he wouldn’t drive a car at all. He’d be on a bike. No, he’d be walking. And he wouldn’t eat burgers. He would eat only locally-sourced vegan food. That he grew himself. Without fertilizers.

Where does it stop? How much change is enough? Who gets to decide who is virtuous and who is ridiculous?

I think of this as all-or-nothing reasoning vs. incrementalism. I know we’re just talking about a cartoon here, but it’s important, because snarky hot-take ridicule is a serious cultural problem. All-or-nothing reasoning says that you either make a great big change or you’re a fraud. But it leads to an unstable situation. We know what lameness is, but it’s hard to say where virtue begins. If I do X, will I still be shamed? All-or-nothing reasoning stops people in their tracks. And it drives away the very people you need to recruit.

Incrementalism, by contrast, is a recipe for action. No matter who you are, no matter where you are, you can always do something. Incrementalism tells you that every little bit helps. Because manifestly, it does! Make a small improvement today. And tomorrow make another one. And then another one the day after that. I’m often mystified as to why we discount incrementalism so ferociously, given that it’s essentially the only way things ever do change. It seems like a flaw in the human operating system.

This tweet is a good comment on what I’m describing.

I’m sick of my fellow urbanists dunking on electric cars for not solving *every single* problem with the transportation system.

No, they don’t. They’re cars. But they’re essential to stopping the climate catastrophe in the actual reality of America.

— Emily Castor Warren (@emilycwarren_) November 30, 2020

All I’m asking is that you give incrementalism a little bit of a chance. See if you like it. Maybe you’ll come back for more tomorrow.

My wife was diagnosed with pancreatic cancer on the day before Thanksgiving in 2018. It made for a somber meal the next day. In the two years since then, my stomach has tightened just before Thanksgiving. I call occasions like this unhappiversaries. Anniversaries of trauma. Maybe it’s the death of a parent. Or the motorcycle accident. Or the day the divorce became final.

We all have unhappiversaries. My question is: what do you do about them?

One answer might be to ignore them. If you can forget them entirely, my hat is off to you. But that’s generally not an option. The memory will push its way in, so the options become to either reject or acknowledge.

I once knew a woman who, along with a friend, was in a terrible motorcycle accident. She spent months in and out of hospitals, her face held in place with pins and plates of steel. We spoke after the anniversary of the crash. I asked her, had she wanted to revisit the site? There was no question. Yes. Something drew her back. She and her friend went to the spot where it happened, were there at the very moment that it happened. And they sat on the side of the road, and they just looked at it. After some time had passed, and without exchanging a word, they drove away. She couldn’t explain why it made sense to go there or why it helped. It hadn’t removed the pain, but it helped to see, to contemplate this spot in her personal geography, this mighty bend in the river of her life.

You might be tempted, instead, to spend the day thinking about anything else, crowding out the memory with noisy distractions. But I’m on the side of acknowledging the darkness. It won’t be ignored. I sometimes personify it with a question: Have I learned what you would teach me? Nothing teaches sympathy like suffering. But you have to listen.

Tragedy shapes us more than joy. Our scars are what distinguish us, after all. My father, a psychiatrist, once put it like this: we are the sum of our imperfections. If you are to be a compassionate friend to your own lonely self, then you must appreciate the landscape after the storm has passed. It tells the story of the storm. It tells the story of you.

How do you observe your unhappiversaries?

Double, double toil and trouble;
Fire burn and cauldron bubble

Everyone knows what a magic spell is. Say the words and things will happen. With the right incantation, you may see the future. Harm your foe. Ward off evil.

You generally need more than just words to make the magic happen. You may need a bubbling cauldron and some special ingredients.

Eye of newt and toe of frog,
wool of bat and tongue of dog.

I want to tell you about a modern charm that is, in every particular, a real and true spell of protection. It is written on a parchment small beyond seeing, rolled in fat, sprinkled with sugar and salt, then doused in an icy bath. Fragile and delicate, it must be handled with extreme care. Even gentle warmth will warp its power. But in the hands of an adept, it will shape the course of nations.

Cool it with a baboon’s blood,
Then the charm is firm and good.

When you are ready, the text is drawn from its freezing cask, streaming fog. An experienced acolyte sits near you and administers the charm, whispering to the very cells inside your body.

And this is how the spell begins: “M F V F L V L L P L V …”

Here is the rough translation:

Know this evil. Mark it well.
It comes for thee, in thee to dwell.
It comes to choke thee in thy sleep.
Choke it first, thy soul to keep.

Please hear me when I say that all of this is true. The spell is an mRNA vaccine, such as the ones created by Pfizer and Moderna to ward off the SARS-CoV-2 coronavirus, better known as COVID. It’s a description (literally “spelled out”) of part of the virus. In magical terms, it’s the tooth of the dog that might bite you. The letters in the text above are from the protein sequence of the very spike protein that punches a hole in your throat. These are the fingers that prize open the windows of your lungs. “Corona” means crown, and these are the spikes on the crown. This is what the vaccine is instructing your immune system to beware of.

So far, I’ve been using the old language of magic. Here is a more modern description. It still has a lovely incantation-like bounce to it, don’t you think?

The Moderna COVID-19 Vaccine (mRNA-1273) is an mRNA vaccine candidate against the novel coronavirus SARS-CoV-2 encoding for a prefusion stabilized form of the spike (S) protein, a class I fusion glycoprotein analogous to influenza haemagglutinin, respiratory syncytial virus (RSV) fusion glycoprotein (F) and human immunodeficiency virus gp160 (Env), and which is the major surface protein on the coronavirus virion and the primary target for neutralizing antibodies.

I want to give you a glimpse of how the message is conveyed. Because it really is spelled out like text on tape. And incidentally, this is why the technique holds great promise for the future. We don’t need to grow our vaccines anymore. We can just type them on a tiny scroll. All you need is a nanoscopic typewriter with a keyboard four letters wide.

The starting sequence in mRNA looks like this.

atgtttgtttttcttgttttattgccactagtc ...

This message gets encoded by your own cells to build a protein out of amino acids.

atg = M = Methionine
ttt = F = Phenylalanine
gtt = V = Valine
ttt = F = Phenylalanine
ctt = L = Leucine
gtt = V = Valine
tta = L = Leucine
ttg = L = Leucine
cca = P = Proline
cta = L = Leucine
gtc = V = Valine
...

This is, of course, just the beginning of a longer sequence that eventually forms the dagger that punches into your chest. Here is the complete sequence. Or you may prefer the graphical version.

And finally, “rolled in fat and sprinkled with sugar and salt”? It’s true. Look at the ingredient list for the Pfizer vaccine: A Breakdown of the Ingredients in the COVID Vaccines. Everything is there for a reason. The mRNA fragments are rolled into little fatty lipid cells to keep them safe. Salts help match the pH, and sugar stabilizes the shape.

And now the charm is nearly ready…

Double, double toil and trouble;
Fire burn and cauldron bubble

UPDATE: I made a guess here as to exactly what sequence they would use for the vaccine. But the actual sequence has now been published. See How Do You Spell Vaccine?

Giraffes have a look: brown puzzle blocks edged with white. Zebras are even more iconic, with those bold contrasty stripes. I don’t know how much good it does them on the Serengeti, but the branding is magnificent.

The interesting question is: how do you paint a zebra? How does a zebra come by its look? By going to the animal print store and searching the Zs? Visiting their favorite stripe salon for a new do? No, they get those stripes at the same store that sold you your fingerprints. The mom store. It’s in the genes. But saying it’s in the genes doesn’t really tell us much. How does it work?

Suppose you want your dining room done up in realistic zebra stripes. Your mom being human, you can’t do the zebra trick. So you go shopping for a quality zebra wallpaper print. That’s a challenge, but let’s assume you find it. Then there are other problems. First, it’s hard to get the paper to line up perfectly so the seams all fit. Next, you’ll notice repeating patterns in your wallpaper, because that’s how wallpaper works. Once you notice it, it will drive you crazy. But real zebras never have this problem. Their patterning is unique, and it shifts perfectly to suit the contours of their body. How?

The answer is that it’s a procedural pattern. There’s a program that paints zebra-ness in just the right way onto the canvas that is Mr. Zebra. And now, through the magic of neural networks, we can do it too. Check out this paper on self-organizing textures from some folks at Google.

Self-Organising Textures

Check it out! It’s mesmerizing, and there are dozens of patterns to play with, including, naturally, the iconic zebra. And since it’s algorithmic, we can give it different conditions. This, for example, is what zebra stripes look like at the south pole.

In the future, everything will be procedural. Architecture, silverware, clothing. If you want zebra stripes in your dining room, all you’ll need to do is specify exactly the area that you want to cover. Then you can just drop a zebra pattern seed in the lower left corner and wait. But we can do the zebra one better. If, next week, you decide it should be a giraffe-themed dining experience, just drop in a giraffe seed.

We’re starting to get a better idea how life cooks up, as Darwin says, “endless forms most beautiful.” I’ll leave you with a link to work by Sage Jenson, who might be one of the first biological artists. These simulations, originally inspired by slime mold self-organization, are essentially living canvases.

View this post on Instagram

A post shared by sage↪️ (@mxsage)

This video is a beautiful visualization of how life finds a way to thrive in adverse circumstances. It provides some insight into what’s going on with the coronavirus as it mutates. The key point is that we think of vaccination as extinguishing a virus, when it’s really just one part of an endless back and forth tennis match. We’re continuously learning from each other and training each other. It never stops.

In the video, an E. coli culture has been placed at the ends of an enormous plate of agar. You can see some some stripes in it. Each stripe is more poisonous than the one before it. The bacterial colony starts in a happy zone with no poison. It grows quickly until it hits the first poison strip (antibiotic). It looks like it’s stalled out, but in a few locations, the bacteria figure out a way (they mutate) to defeat the effect of the poison, and you see another breakout. All the “children” who continue on are descended from the clever bacterium that cut the hole in the fence.

This process is repeated three more times. The progress of the colony is stymied… until somebody cuts through the next fence, and the relentless march continues. In other words, we may think we’re making a prison for bacteria, but it’s more useful to think of it as a training center for ninja commando bacteria!

The superimposed colored lines show branching trees of inheritance. The bacteria that reach the red “end zone” have had to adapt to life-threatening poison multiple times. Is their appearance in a sea of toxic sludge miraculous or inevitable? It’s hard to know ahead of time, but there they are. Life finds a way.

Here is the video. This is not a notional diagram or cartoon. You’re watching genuine evolution, the engine of life’s variety, happen before your eyes. There it is! If Darwin believed in heaven and was there right now, he’d be smiling at this. But I think he’s just dead. Anyway, press “play” already…

Here is a similar-looking tree diagram for the coronavirus, as maintained on Nextstrain.org. As before, each branch represents a successful mutation. Maybe it was in response to some stress, or maybe it was just random. But from just a few virus particles on the left side comes a fantastic woolly forest of viral variation on the right. It never stops.

We now have the magic goggles that let us watch evolution like a spectator sport. Nextstrain even has this fascinating “market share” diagram. Some strains do better. Some do worse. The ones that do better get to make more copies. It’s as simple, and as complicated, as that.

And it never ever stops.

Welcome to February, and happy 139th birthday James Joyce!

Groundhog Day is a cross-quarter day, halfway from solstice to equinox. I think of the quarter days (solstices and equinoxes) as being pivot days for heat, and cross-quarter days as being pivot days for light. So it starts getting really cold in late December, but it takes a while for you to truly notice that the days are getting longer. It takes, roughly speaking, until now. Groundhog Day can be celebrated as the return of the light. It’s still cold, but from now on winter is fighting a losing battle. It’s on its back foot. You can only go halfway into a tunnel. After that, you’re going out of it. That’s where we are. Heading out of winter.

In a somewhat larger sense, we might say that we’re on our way out of a number of unpleasant ordeals. We’re still in the tunnel. But hey! Breathe a little easier. We’re on the way out. The light is returning.

A new form of manufacturing is finally bearing fruit. The old form of manufacturing is the assembly line. The very phrase “assembly line” is synonymous with rapid and efficient manufacturing. But soon we’ll do much better. The funny thing is that the new form of manufacturing is the most ancient of all: gestation. Call it Womb 2.0.

You can call it 3D printing if you prefer, but I think that misses the biggest point here. We’re actually moving forward to (and back to) a biological model. Consider the cow. All she needs is some grass (and a small DNA download) and she can build you another cow. All the articulation, all the value-add, is done in utero, on site. She doesn’t have to coordinate a far-flung network of horn suppliers, udder contractors, and hoof makers. She doesn’t manage warehoused inventories of tongue and tail sub-assemblies. She doesn’t even need a lot of space.

cow + cheap local materials + digital spec + time = new cow

You might think, compared to assembly lines, that this biological construction model can’t scale. Except for the fact that it obviously can. Every farm product you’ve ever consumed was first created at the scale of one animal or plant at a time. Every egg came from exactly one chicken. It’s a different kind of scaling from Ford’s River Rouge Complex, but it does scale. And it scales in the simplest possible way. Need more stuff? Make more wombs. Need different stuff? Give the wombs different instructions.

Scale works in the other direction, too. Wombs have the ability to scale down in a way that assembly lines don’t. You would never build an assembly line to make a dozen items. You need to know that you’re going to build thousands of units. This requires you to make enormous bets on products. But with a womb-based construction, your cost floor is much lower. You can make small bets and only scale up when it pays off. The flexibility this gives you is breathtaking. You can tweak designs and optimize in a way that is truly biological, with small variations that will propagate if successful.

Plenty has been written about 3D printing. The reason I’m especially excited about 21st century gestation right now is because I’m seeing a critical mass of real businesses on the verge of making real money. What we’ve talked about is happening.

• Mighty Buildings prints small buildings with a UV-cured resin.
• Relativity Space prints rockets with the world’s largest metal printer.
• Czinger prints the 21C hypercar.

All these companies use a tiny amount of manufacturing floor space relative to their old-school alternatives. They work with relatively simple raw material inputs, and they can be modulated rapidly by software.

womb + raw material + digital spec + time = new product (=> profit!)

I think it’s worthwhile to think of this process not as 3D printing, but as gestation. We’re finally learning from the master.

The cow has much to teach us.

I love my toilet seat.

Some product are so well designed that they bring delight every single time you use them. My toilet seat is a slow-close toilet seat. That means I don’t have to worry about it slamming down with an ear-splitting BANG! I don’t have to lower it with anxious care. Just give it a tip and it floats … gracefully … downward like an autumn leaf dropping noiselessly onto still water. I always HATED that bang, so it makes me happy every time, knowing blissful silence will prevail.

I know there’s nothing especially novel or groundbreaking about my slow-close toilet seat. You probably have one too. I only mention it as an example of delightful design. But now I’m going to give you some news you really can use.

Friends, this is the Canary Corrugated Cardboard Cutter, designed by a Japanese super genius and shipped to your door for less than ten dollars. Of course, it’s only useful if you happen to have a lot corrugated cardboard sitting around. What’s that, my friend? You DO have a lot of corrugated cardboard sitting around? Because every single thing you’ve purchased since last March, from your yoga mat to individual slices of cheese, comes packaged in corrugated cardboard? And your garage is stacked from floor to ceiling with the stuff?

In that case, my friend, this product is going to change your life. It makes me blush to pitch it like a copywriter in heat, but I’m only saying this because I want my joy to be your joy. This cutter has, as of this writing, 2402 five-star ratings on Amazon. In the comments people have written love poetry to it.

In my pre-Canary days, my wife would ask me to break down boxes for recycling and I would dread the chore. Even with serious box-cutter razor blades, it was slow work, stressful on the hands and wrists. Not to mention the ever-present threat of slicing an artery. The folks at the recycling center frown on cardboard that has been dowsed with jets of hot blood.

The Canary is so cleverly designed that it presents no danger of blood-letting, yet it is effortlessly lethal to the box. I wield it like a tiny lightsaber, burning through cardboard sinews and joints. Then I stare at it in admiration, wondering how it manages its work so well. It is almost a pleasure to dispatch a big box into the tasty flakes that my recycling bin can ingest. As with the toilet seat, an erstwhile source of stress recedes and you are deposited into a quieter, a brighter world. A saner world. Pray enjoy it before you become accustomed!

Buy it here: Canary Corrugated Cardboard Cutter

The box it ships in will be the last box you open without it.