Thinking about Nothing: Stuff and Nega-stuff

I once read an article about the phantom traffic jams that seem to crop up at random. So there’s no accident or road closure, just a wicked knot that mysteriously slows you to a crawl, and then just as mysteriously lets you go. It turns out that, once traffic reaches a critical volume, it only takes one person stomping on the brakes to form that knot, and then it might take an hour or more to clear.

If you’re stuck in a jam like this, what can you do about it? The author had a ready answer: feed it space. I understood what he meant. Don’t crowd the car in front of you. But I also like how he put it. Feed nothing into the traffic jam.

Turning nothing into something, or turning inaction into an action, can be an extraordinarily effective brain tool.

In the semiconductor physics that govern things like transistors, scientists find it useful to talk about electrons, which are bona fide things, and “holes”, which are the places where electrons aren’t. Holes are notional particles of non-particle-ness, a convenient shorthand that comes about when we refer to the absence of something as something.

You can see this phenomenon many places. A vacuum is another example. The vacuum isn’t sucking things into it. The vacuum is the absence of pushing. But we find it convenient to talk about a vacuum as a thing that sucks. It’s not a logical flaw so much as a reframing that simplifies our reasoning.

My favorite example of positive negation comes in the energy industry. Imagine you’re running a power grid in Hotsylvania. It’s a scorching day in July and everyone has their air conditioners on. As more demand comes online, you have to switch on more power plants. What else can you do? As it happens, there is an alternative. Let’s further suppose that you’ve set up a demand management program in which customers agree to decrease their demand at your request. Here is the key insight: from your point of view as the system operator, a “negative power plant” that reduces demand is just as useful as a positive power plant that increases supply. They both do the same thing to the energy balance equation. And once you make this conceptual breakthrough, it’s easy to see that not building a new power plant is likely to be much cheaper than building a new power plant.

Amory Lovins, founder of the Rocky Mountain Institute, referred to unrealized energy efficiency as “negawatts”. It’s the amount of power you might NOT use. Negawatts let you reason about loss and inefficiency as a “thing”, such that you might be able to do something about it. He liked to say that the United States is the Saudi Arabia of negawatts. If you can find a way to make money out of inefficiency, then negawatts become a resource that can make you rich. We’ve got heaps of the stuff.

Lovins applied this logic to the U.S. car industry, pointing out that our big petroleum-powered cars represent a huge negawatt reserve. Using the geological terminology of the oil extraction business, he called this the “Detroit Formation.” If you can sell a more efficient vehicle, and these days it’s clear you can, then you can make a fortune by tapping into the negawatts buried deep under Detroit.

Thinking about nothing as something doesn’t really change anything physical. But it makes new thinking possible. I even find it useful in the kitchen. If I want to eat less, instead of moaning that I can’t eat anything, I make a positive message: I can eat all the nothing I want. I’m consuming nega-calories. Or to return to the story about how to fix the traffic jam, instead of saying “Don’t drive fast”, I can say “Feed the jam some lovely space.” Obviously the outcome is the same, but I prefer the second message. It matters because it makes a difference to my brain, and so it makes a difference to my behavior.

We almost always want to solve our problems with more stuff. But often the most effective solution is with nega-stuff.

Cereal Box Arms Race

Cereal boxes, much like the competing trees in a tropical rain forest, need radiation to survive. For trees this radiation comes from the sun. For cereal boxes, you provide the attention radiation that illuminates and nourishes them. This so-called “att-rad” can lead to the next stage of the cereal box life cycle, grocery cartosis, in which harvested goods are placed in the cart and transported out of the store. Cartosis is followed by deposition in the kitchen cabinet reticulum for storage, and ultimately consumption by the human host. Competition for att-rad is, therefore, a deadly serious business, and much studied by consumer ecologists at organizations such as Unilever, Proctor & Gamble, and Frostie-Krunch Consolidated Heavy Carbohydrates, Inc.

One especially valuable and selected-for trait in the cereal aisle canopy is box height. Here we see the mighty Special-K box towering over a nearby companion. The monster in this picture was measured at close to 340 millimeters! On the shelves of the cereal forest, that diverse and superheated environment where boxes are harvested, this trait serves it well. Taller boxes appear to attract more of the precious and life-bestowing attention radiation from potential human hosts.

But beware! All phenotypes have maladaptive tradeoffs. The tall trees of the rain forest must cope with the hazard of being so tall that they pitch over in the wind. And this noble Special K box now finds itself in the awkward position of being poorly adapted for storage in the cabinet reticulum of the host’s kitchen-plasm. It’s too tall for its new home! To circumvent this problem, the fruit of the Special K box has been grafted onto a sturdy wild-type Chex box, as close inspection of this image will reveal. The Crispix fruit has suffered a similar fate. This cross-grafting can be an irritant to the human host.

Ultimately, box height comes at a steep ecological price. Here we see the remains of the box exoskeleton cast off into the recycling compost of the kitchen floor. All the energy that went into the box will now be passed to that ravenous detrivore, the recycling bin (Receptaclus cardboardi). Box height is energetically expensive, and it can irritate the human host, who must prematurely shuck and discard this extravagant cereal integument and then graft the fruit to a surrogate species. All to chase the fickle attention radiation that beams daily from your eyes. Is it worth it? Is this a stable and successful reproductive strategy? Evolutionary time will tell.

Everything is getting better and worse at the same time

“The truth will set you free, but first it will make you miserable.”

It’s late at night. You shuffle to the kitchen for a snack. Your hand fumbles briefly for the light switch, and… roaches! They quickly scatter, but now you’ve seen them. You know they’re there. From now on, you can’t not think about the roaches in the kitchen. It’s a shame, too, because you always thought of yourself as a neat person with a clean kitchen. But now that image has been ruined. The good news is, now you have better information about the world. You DO have roaches in your kitchen, and you can start to do something about it.

The Roach Reveal story is how I think about one of our modern patterns of experience: everything is getting better and worse at the same time. These days we’re getting ever more powerful sensors that show us the virtual vermin that lurk beneath the veneers of civilization. We’re seeing roaches we never knew were there. It feels like we’re being hammered endlessly by terrible news. But look closer: the roaches were always there. And now we can start to do something about it. And often it’s only when we realize just how bad it is that we finally decide to take action.

Related to this topic, I want to convince you to read The Alignment Problem by Brian Christian. This book addresses the dangers associated with machine learning, smart robots, and clever algorithms of all kinds. The title refers to a subtle and disturbing fact: it’s strangely difficult to tell a computer what you want it to do. You can tell it to do something that is what you THINK you want it to do. And then it will, with dizzying speed and precision, set about making you miserable, all while doing exactly what you asked. This is often described in terms of deal-with-the-devil jokes: tell the computer to stop people from getting malaria, and it will murder everyone before they can catch malaria. “I solved your problem!” says the robot. “You killed my family!” says the programmer. That’s the alignment problem. It’s not a joke.

One of the topics in the book is algorithmic bias. Suppose you want to teach a robot to hire good employees. Or decide who should get a loan. Or maybe decide who should be paroled from jail. After you implement some pretty straightforward machine learning, you are almost certain to be disturbed by the results. The computer has learned from a horribly biased society. What else could it learn from? Naturally it mirrors back to us racism, sexism, and xenophobia.

Machine learning is the kitchen light. It’s illuminating the roaches that have been crawling through our brains and institutions for hundreds of years. Switching on these algorithms feels like a massive step backwards. We are in danger of encoding extraordinarily efficient prejudice. But the book comes with good news too. No matter how unhappy the kitchen light first makes you, it will also help you solve the problem. Seeing how biased our algorithms are, we can set about attacking the root cause. The root cause is not the kitchen light.

Our computers can teach us to be better humans.

How Do You Spell Vaccine?

This post is a follow-up to one that I did back in February: A Modern Magical Spell. There I was ruminating about the fact that, whereas old-school vaccines included little chunks of the virus itself, the Pfizer and Moderna mRNA vaccines are instructions, blueprints, that tell your body how to make those little viral chunks. They are, in effect, cellular DIY projects.

It sounds like a minor point, but the difference is huge. Sending messages is easier and more flexible than sending the thing that the message encodes. Why send cookies if you can just send the recipe? Why send a string quartet if you can just send the sheet music? Blueprints are cheaper than bricks.

Anyway, I’m writing about the same thing again because we now know exactly what text is in the vaccine. Text messages are convenient for a number of reasons, and one is that they’re easy for us to read. Think about this: the syringe that pokes you in the arm is a bottle with a message. Uncork the bottle, unroll the message, and you can see, you can just read off, exactly what protein sequence the vaccine codes for. Some folks at Stanford have done exactly that: Stanford Scientists Post mRNA Sequence for Moderna Vaccine on Github. They didn’t want to get in trouble for stealing anyone’s shot, so they did the equivalent of sifting through the trash for valuable documents: “RNAs were obtained as discards from the small portions of vaccine doses that remained in vials after immunization.”

Pfizer didn’t want to publish this information… only they did publish it. They published millions of copies into little vials and distributed them across the country. For my previous piece, I made a guess as to the sequence that was used for encoding the spike protein. No surprise, my guess was wrong. But the good news is that the actual answer is posted on GitHub. Check out the fancy title: Assemblies of putative SARS CoV2 spike encoding mRNA sequences for vaccines BNT-162b2 and mRNA-1273.

Do you want to know the actual recipe for that BNT-162b2 vaccine? The actual text that would be injected into your bloodstream? Here it is.

GAGAATAAACTAGTATTCTTCTGGTCCCCACAGACTCAGAGAGAACCCGCCACCATGTTCGTGTTCCTGGTGCTGCTGCC
TCTGGTGTCCAGCCAGTGTGTGAACCTGACCACCAGAACACAGCTGCCTCCAGCCTACACCAACAGCTTTACCAGAGGCG
TGTACTACCCCGACAAGGTGTTCAGATCCAGCGTGCTGCACTCTACCCAGGACCTGTTCCTGCCTTTCTTCAGCAACGTG
ACCTGGTTCCACGCCATCCACGTGTCCGGCACCAATGGCACCAAGAGATTCGACAACCCCGTGCTGCCCTTCAACGACGG
GGTGTACTTTGCCAGCACCGAGAAGTCCAACATCATCAGAGGCTGGATCTTCGGCACCACACTGGACAGCAAGACCCAGA
GCCTGCTGATCGTGAACAACGCCACCAACGTGGTCATCAAAGTGTGCGAGTTCCAGTTCTGCAACGACCCCTTCCTGGGC
GTCTACTACCACAAGAACAACAAGAGCTGGATGGAAAGCGAGTTCCGGGTGTACAGCAGCGCCAACAACTGCACCTTCGA
GTACGTGTCCCAGCCTTTCCTGATGGACCTGGAAGGCAAGCAGGGCAACTTCAAGAACCTGCGCGAGTTCGTGTTTAAGA
ACATCGACGGCTACTTCAAGATCTACAGCAAGCACACCCCTATCAACCTCGTGCGGGATCTGCCTCAGGGCTTCTCTGCT
CTGGAACCCCTGGTGGATCTGCCCATCGGCATCAACATCACCCGGTTTCAGACACTGCTGGCCCTGCACAGAAGCTACCT
GACACCTGGCGATAGCAGCAGCGGATGGACAGCTGGTGCCGCCGCTTACTATGTGGGCTACCTGCAGCCTAGAACCTTCC
TGCTGAAGTACAACGAGAACGGCACCATCACCGACGCCGTGGATTGTGCTCTGGATCCTCTGAGCGAGACAAAGTGCACC
CTGAAGTCCTTCACCGTGGAAAAGGGCATCTACCAGACCAGCAACTTCCGGGTGCAGCCCACCGAATCCATCGTGCGGTT
CCCCAATATCACCAATCTGTGCCCCTTCGGCGAGGTGTTCAATGCCACCAGATTCGCCTCTGTGTACGCCTGGAACCGGA
AGCGGATCAGCAATTGCGTGGCCGACTACTCCGTGCTGTACAACTCCGCCAGCTTCAGCACCTTCAAGTGCTACGGCGTG
TCCCCTACCAAGCTGAACGACCTGTGCTTCACAAACGTGTACGCCGACAGCTTCGTGATCCGGGGAGATGAAGTGCGGCA
GATTGCCCCTGGACAGACAGGCAAGATCGCCGACTACAACTACAAGCTGCCCGACGACTTCACCGGCTGTGTGATTGCCT
GGAACAGCAACAACCTGGACTCCAAAGTCGGCGGCAACTACAATTACCTGTACCGGCTGTTCCGGAAGTCCAATCTGAAG
CCCTTCGAGCGGGACATCTCCACCGAGATCTATCAGGCCGGCAGCACCCCTTGTAACGGCGTGGAAGGCTTCAACTGCTA
CTTCCCACTGCAGTCCTACGGCTTTCAGCCCACAAATGGCGTGGGCTATCAGCCCTACAGAGTGGTGGTGCTGAGCTTCG
AACTGCTGCATGCCCCTGCCACAGTGTGCGGCCCTAAGAAAAGCACCAATCTCGTGAAGAACAAATGCGTGAACTTCAAC
TTCAACGGCCTGACCGGCACCGGCGTGCTGACAGAGAGCAACAAGAAGTTCCTGCCATTCCAGCAGTTTGGCCGGGATAT
CGCCGATACCACAGACGCCGTTAGAGATCCCCAGACACTGGAAATCCTGGACATCACCCCTTGCAGCTTCGGCGGAGTGT
CTGTGATCACCCCTGGCACCAACACCAGCAATCAGGTGGCAGTGCTGTACCAGGACGTGAACTGTACCGAAGTGCCCGTG
GCCATTCACGCCGATCAGCTGACACCTACATGGCGGGTGTACTCCACCGGCAGCAATGTGTTTCAGACCAGAGCCGGCTG
TCTGATCGGAGCCGAGCACGTGAACAATAGCTACGAGTGCGACATCCCCATCGGCGCTGGAATCTGCGCCAGCTACCAGA
CACAGACAAACAGCCCTCGGAGAGCCAGAAGCGTGGCCAGCCAGAGCATCATTGCCTACACAATGTCTCTGGGCGCCGAG
AACAGCGTGGCCTACTCCAACAACTCTATCGCTATCCCCACCAACTTCACCATCAGCGTGACCACAGAGATCCTGCCTGT
GTCCATGACCAAGACCAGCGTGGACTGCACCATGTACATCTGCGGCGATTCCACCGAGTGCTCCAACCTGCTGCTGCAGT
ACGGCAGCTTCTGCACCCAGCTGAATAGAGCCCTGACAGGGATCGCCGTGGAACAGGACAAGAACACCCAAGAGGTGTTC
GCCCAAGTGAAGCAGATCTACAAGACCCCTCCTATCAAGGACTTCGGCGGCTTCAATTTCAGCCAGATTCTGCCCGATCC
TAGCAAGCCCAGCAAGCGGAGCTTCATCGAGGACCTGCTGTTCAACAAAGTGACACTGGCCGACGCCGGCTTCATCAAGC
AGTATGGCGATTGTCTGGGCGACATTGCCGCCAGGGATCTGATTTGCGCCCAGAAGTTTAACGGACTGACAGTGCTGCCT
CCTCTGCTGACCGATGAGATGATCGCCCAGTACACATCTGCCCTGCTGGCCGGCACAATCACAAGCGGCTGGACATTTGG
AGCAGGCGCCGCTCTGCAGATCCCCTTTGCTATGCAGATGGCCTACCGGTTCAACGGCATCGGAGTGACCCAGAATGTGC
TGTACGAGAACCAGAAGCTGATCGCCAACCAGTTCAACAGCGCCATCGGCAAGATCCAGGACAGCCTGAGCAGCACAGCA
AGCGCCCTGGGAAAGCTGCAGGACGTGGTCAACCAGAATGCCCAGGCACTGAACACCCTGGTCAAGCAGCTGTCCTCCAA
CTTCGGCGCCATCAGCTCTGTGCTGAACGATATCCTGAGCAGACTGGACCCTCCTGAGGCCGAGGTGCAGATCGACAGAC
TGATCACAGGCAGACTGCAGAGCCTCCAGACATACGTGACCCAGCAGCTGATCAGAGCCGCCGAGATTAGAGCCTCTGCC
AATCTGGCCGCCACCAAGATGTCTGAGTGTGTGCTGGGCCAGAGCAAGAGAGTGGACTTTTGCGGCAAGGGCTACCACCT
GATGAGCTTCCCTCAGTCTGCCCCTCACGGCGTGGTGTTTCTGCACGTGACATATGTGCCCGCTCAAGAGAAGAATTTCA
CCACCGCTCCAGCCATCTGCCACGACGGCAAAGCCCACTTTCCTAGAGAAGGCGTGTTCGTGTCCAACGGCACCCATTGG
TTCGTGACACAGCGGAACTTCTACGAGCCCCAGATCATCACCACCGACAACACCTTCGTGTCTGGCAACTGCGACGTCGT
GATCGGCATTGTGAACAATACCGTGTACGACCCTCTGCAGCCCGAGCTGGACAGCTTCAAAGAGGAACTGGACAAGTACT
TTAAGAACCACACAAGCCCCGACGTGGACCTGGGCGATATCAGCGGAATCAATGCCAGCGTCGTGAACATCCAGAAAGAG
ATCGACCGGCTGAACGAGGTGGCCAAGAATCTGAACGAGAGCCTGATCGACCTGCAAGAACTGGGGAAGTACGAGCAGTA
CATCAAGTGGCCCTGGTACATCTGGCTGGGCTTTATCGCCGGACTGATTGCCATCGTGATGGTCACAATCATGCTGTGTT
GCATGACCAGCTGCTGTAGCTGCCTGAAGGGCTGTTGTAGCTGTGGCAGCTGCTGCAAGTTCGACGAGGACGATTCTGAG
CCCGTGCTGAAGGGCGTGAAACTGCACTACACATGATGACTCGAGCTGGTACTGCATGCACGCAATGCTAGCTGCCCCTT
TCCCGTCCTGGGTACCCCGAGTCTCCCCCGACCTCGGGTCCCAGGTATGCTCCCACCTCCACCTGCCCCACTCACCACCT
CTGCTAGTTCCAGACACCTCCCAAGCACGCAGCAATGCAGCTCAAAACGCTTAGCCTAGCCACACCCCCACGGGAAACAG
CAGTGATTAACCTTTAGCAATAAACGAAAGTTTAACTAAGCTATACTAACCCCAGGGTTGGTCAATTTCGTGCCAGCCAC
ACCCTGGAGCTAGCA

There it is! That’s the payload. That’s what the fuss is all about. It gives me a thrill to look at it. It may look like a mess, but the ribosomes in your cells can read it like a recipe. So we might say that you can’t read it, but “you” can. Because you can. And you will. And it might save your life.

As biology becomes more and more of an information science, many strange and wonderful things will become possible. We’re still at the “Mr. Watson, come here, I want to see you” stage of communication.

Outsourcing Humanity

A cooking pot is an outsourced stomach. It shifts much of the burden of digesting food from inside to outside your body. Because of this, your real stomach doesn’t have to work so hard. This was a big deal for early humans, allowing them to make more effective use of available food.

Consider the shift that followed. Over millions of years, animals slowly evolved stomachs that could digest their preferred diet. This internal stomach is encoded in DNA, in the genome. Then, one fine day, fire-savvy, cook-capable humans came along. The job of the stomach could now be shared between the pot and the belly, which means that the combined “big stomach” is now a joint venture encoded by both genetic and cultural DNA. Across many generations, the biological stomach can now “relax”. Not only does it do less work, it can even give up some its ability to do the hard work of digesting raw food. Why bother, as long as you have a microwave handy? In this sense, you become a hybrid biological-cultural construct, as dependent on the cultural knowledge of cooking and pot-making as on your own self-constructing DNA. How long would you survive naked in the wilderness?

What’s true for cooking is true for many things. Knives outsource teeth. Clothes outsource skin. Glasses outsource vision. We make our tools and our tools make us. It’s an obvious statement and a profound one, particularly when you consider medicine.

Across the millennia, pathogens have sculpted our genome. Traits that have helped previous generations survive the ravages of malaria, plague, and tuberculosis get built into our genes. We have the tracks of thousands of pandemics etched into our genetic memory. But now, just as with our stomachs and our teeth, we are outsourcing, externalizing our immune system. This modern plague is reshaping not so much our genetics as our global cultural medical apparatus. Pfizer, Moderna, and AstraZeneca can do in one year what a deadly plague might have needed a hundred years and fifty million lives to impart to our genes. Our genes don’t need to improve so long as our medical care does. Put another way, our biological immune system is now free to get weaker, so long as biotechnology can carry its load. It doesn’t take a great leap of imagination to see us, across several hundred years, fading into our sustaining machinery. With it, we are gods. Without it, we are shrieking infants.

But the coming world will also give us the ability to upgrade not only our machines, but also our genes. Here’s one simple example of what that might look like.

As noted, traits that are not needed for survival tend to fade. This is why you can’t smell as well as a dog. You share with dogs a lot of the same DNA for sensing specific odors, but in humans, much of this DNA has been damaged and rendered inert. If a few bulbs burn out in your smell-o-nator, who cares? You can still have healthy kids. Over time, humans have lost the cunning of the canine nose. But that doesn’t have to be true forever. We can not only build outsourced spectrometers and mechanical noses, we will also be able to retrofit our DNA. This will be a dangerous and subtle skill to learn, but be certain it will come. In the future, wealthy parents will be able to endow their offspring with, among other things, the smelling capabilities of dog. I don’t know if that’s a good idea, but I’m telling you, it’s coming.

Would you pay to give your children a superhuman sense of smell? Or the ability to see colors no human ever saw?

Strava Heatmaps on the Cheap

Strava has been wildly successful at getting people to surrender their privacy in the name of bragging about fitness. You log your activity on the Strava website, and from this you can make personalized maps. You can even share this information up into a global heatmap database, from which Strava can show you where EVERYBODY has been running and biking and snowshoeing and paragliding and dolphin-riding and so on.

It’s a lot of fun to play around with. Shown below, we’re zoomed in on Cambridge and Boston. It’s no surprise that busy streets are busy, but I like how you can see exactly where the gaps are under the Harvard Bridge. The Charles River looks like a highway. Which, for the purposes of sport (and fish), it is.

I was jealous of these personal activity maps, but not jealous enough to spend the money on Strava. That was when I remembered something important, something that I try to remind myself on a regular basis: whenever you imagine a potential app or web service, you cause somebody to retroactively make it for you. That is to say, your idea isn’t original, so someone has already done it for you. All you have to do is say “All-seeing Google, show me the thing that does X.”

As in the sentence: “Show me the site that will let me make my own Strava-like heatmaps for free.”

I know this is kind of obvious, but sometimes I forget to actually make a pointed request for something that is vaguely floating around in my mind. I’m kind of thinking about it (“gee, that Strava heatmap is cool…”), but I don’t articulate the specific question. This means that the app never gets retroactively created by internet elves on my behalf. You see how it works? The magic never happens.

Anyway, I was not disappointed. I was led very quickly t0 dérive by Erik Price. It’s free! It’s open source (MIT license)! It’s very good, and it works like a charm. Huzzah! How I love the new millennium. And thank you, Erik.

You just bring your own GPX files to the dérive website, and then drag them onto the browser. All the work happens in the browser, so you’re not actually sending any of the files back up to the site.

This pandemic has given me a lot of time to walk around my hometown, and my completionist tendencies coupled with a nice route-planning app (Footpath) have given me the motivation to explore.

How it started:

How it’s going:

You’d be amazed how many roads are close to you that you’ve never been on.

Washing Machines Large and Small

Here is a picture of two different factories that do the same thing: turn atmospheric nitrogen into ammonia.

The one on the left is a gigantic Haber process plant. It requires fantastic amounts of heat and pressure to do its work. Plants like this consume 3-5% of the entire world’s natural gas output. The one on the right is an enzyme: nitrogenase. It can do its work in the roots of the clover growing in your front yard, all with very little risk of an explosive industrial accident.

This vignette shows one of the biggest lessons that biology has to teach us: how to do useful chemistry with much less effort. Which has all kinds of benefits, as you can imagine.

People hear the terms “biotech” and “synthetic biology” and it’s no surprise that the pharmaceutical industry is what springs to mind. After all, we live in the shadow of The Virus. I don’t want to diminish the miracles being worked by the mRNA hackers at Moderna and Pfizer, but I do want to point how much synthetic biology is already doing for us in non-medical settings. This article about Frances Arnold provides a couple of real world examples.

Here’s a laundry-related story.

Up to 80% of your washing machine’s energy use comes from heating the water. But cold water wash is the way to go these days, thanks to engineered enzymes. Your laundry detergent contains eight or more enzymes, all designed to do the work that hot water used to. So do yourself and the planet a favor: set your wash cycle to “cold” and let engineered enzymes save energy and expense with every load.

I like this example because it highlights the same big machine/small machine dichotomy I described above. You can do a lot of work at high heat with a big machine (the washer), or you can do much less work in cold water with many small machines (enzymatic molecules). It seems like a cute example, but it’s real and it matters. There are many more stories like it.

So set that cycle to cold! One day we’ll look back and laugh at how profligate we were with our energy. Or maybe we’ll cry. Or maybe we won’t be here because we played with fire for too long.

Oooh, that got dark. Let’s go with laugh.

The Virtues of Incrementalism

I came across a cartoon the other day. Maybe you’ve seen it too. This is my re-drawn version of it, to give you the general idea. A guy pulls up to a burger place in a big gas-guzzling car. Smoke pours from the tailpipe. He’s about to take his order, but then he draws back: “No plastic bags for me. I care about the environment!”

Big Car Burger Guy is such a dope! He’s an easy target for ridicule. But ultimately I think making fun of him is unhelpful. I want Big Car Burger Guy to swear off plastic. Good for you, Big Car Burger Guy! If that’s all he can do today, then that’s okay with me. He’s moving in the right direction. I hope he’ll do more tomorrow, but I guarantee you that if I make fun of him today, it won’t lead to a better outcome tomorrow.

Let’s go back to the cartoon. It’s funny because if Big Car Burger Guy really cared about the environment, he would… what? Well, let’s see. He wouldn’t drive a car powered with fossil fuels. Actually, he wouldn’t drive a car at all. He’d be on a bike. No, he’d be walking. And he wouldn’t eat burgers. He would eat only locally-sourced vegan food. That he grew himself. Without fertilizers.

Where does it stop? How much change is enough? Who gets to decide who is virtuous and who is ridiculous?

I think of this as all-or-nothing reasoning vs. incrementalism. I know we’re just talking about a cartoon here, but it’s important, because snarky hot-take ridicule is a serious cultural problem. All-or-nothing reasoning says that you either make a great big change or you’re a fraud. But it leads to an unstable situation. We know what lameness is, but it’s hard to say where virtue begins. If I do X, will I still be shamed? All-or-nothing reasoning stops people in their tracks. And it drives away the very people you need to recruit.

Incrementalism, by contrast, is a recipe for action. No matter who you are, no matter where you are, you can always do something. Incrementalism tells you that every little bit helps. Because manifestly, it does! Make a small improvement today. And tomorrow make another one. And then another one the day after that. I’m often mystified as to why we discount incrementalism so ferociously, given that it’s essentially the only way things ever do change. It seems like a flaw in the human operating system.

This tweet is a good comment on what I’m describing.

All I’m asking is that you give incrementalism a little bit of a chance. See if you like it. Maybe you’ll come back for more tomorrow.

Source: ncse.ngo

What Do You Do About Unhappiversaries?

My wife was diagnosed with pancreatic cancer on the day before Thanksgiving in 2018. It made for a somber meal the next day. In the two years since then, my stomach has tightened just before Thanksgiving. I call occasions like this unhappiversaries. Anniversaries of trauma. Maybe it’s the death of a parent. Or the motorcycle accident. Or the day the divorce became final.

We all have unhappiversaries. My question is: what do you do about them?

One answer might be to ignore them. If you can forget them entirely, my hat is off to you. But that’s generally not an option. The memory will push its way in, so the options become to either reject or acknowledge.

I once knew a woman who, along with a friend, was in a terrible motorcycle accident. She spent months in and out of hospitals, her face held in place with pins and plates of steel. We spoke after the anniversary of the crash. I asked her, had she wanted to revisit the site? There was no question. Yes. Something drew her back. She and her friend went to the spot where it happened, were there at the very moment that it happened. And they sat on the side of the road, and they just looked at it. After some time had passed, and without exchanging a word, they drove away. She couldn’t explain why it made sense to go there or why it helped. It hadn’t removed the pain, but it helped to see, to contemplate this spot in her personal geography, this mighty bend in the river of her life.

You might be tempted, instead, to spend the day thinking about anything else, crowding out the memory with noisy distractions. But I’m on the side of acknowledging the darkness. It won’t be ignored. I sometimes personify it with a question: Have I learned what you would teach me? Nothing teaches sympathy like suffering. But you have to listen.

Tragedy shapes us more than joy. Our scars are what distinguish us, after all. My father, a psychiatrist, once put it like this: we are the sum of our imperfections. If you are to be a compassionate friend to your own lonely self, then you must appreciate the landscape after the storm has passed. It tells the story of the storm. It tells the story of you.

How do you observe your unhappiversaries?

A Modern Magical Spell

Double, double toil and trouble;
Fire burn and cauldron bubble

Everyone knows what a magic spell is. Say the words and things will happen. With the right incantation, you may see the future. Harm your foe. Ward off evil.

You generally need more than just words to make the magic happen. You may need a bubbling cauldron and some special ingredients.

Eye of newt and toe of frog,
wool of bat and tongue of dog.

I want to tell you about a modern charm that is, in every particular, a real and true spell of protection. It is written on a parchment small beyond seeing, rolled in fat, sprinkled with sugar and salt, then doused in an icy bath. Fragile and delicate, it must be handled with extreme care. Even gentle warmth will warp its power. But in the hands of an adept, it will shape the course of nations.

Cool it with a baboon’s blood,
Then the charm is firm and good.

When you are ready, the text is drawn from its freezing cask, streaming fog. An experienced acolyte sits near you and administers the charm, whispering to the very cells inside your body.

And this is how the spell begins: “M F V F L V L L P L V …”

Here is the rough translation:

Know this evil. Mark it well.
It comes for thee, in thee to dwell.
It comes to choke thee in thy sleep.
Choke it first, thy soul to keep.

Please hear me when I say that all of this is true. The spell is an mRNA vaccine, such as the ones created by Pfizer and Moderna to ward off the SARS-CoV-2 coronavirus, better known as COVID. It’s a description (literally “spelled out”) of part of the virus. In magical terms, it’s the tooth of the dog that might bite you. The letters in the text above are from the protein sequence of the very spike protein that punches a hole in your throat. These are the fingers that prize open the windows of your lungs. “Corona” means crown, and these are the spikes on the crown. This is what the vaccine is instructing your immune system to beware of.

So far, I’ve been using the old language of magic. Here is a more modern description. It still has a lovely incantation-like bounce to it, don’t you think?

The Moderna COVID-19 Vaccine (mRNA-1273) is an mRNA vaccine candidate against the novel coronavirus SARS-CoV-2 encoding for a prefusion stabilized form of the spike (S) protein, a class I fusion glycoprotein analogous to influenza haemagglutinin, respiratory syncytial virus (RSV) fusion glycoprotein (F) and human immunodeficiency virus gp160 (Env), and which is the major surface protein on the coronavirus virion and the primary target for neutralizing antibodies.

I want to give you a glimpse of how the message is conveyed. Because it really is spelled out like text on tape. And incidentally, this is why the technique holds great promise for the future. We don’t need to grow our vaccines anymore. We can just type them on a tiny scroll. All you need is a nanoscopic typewriter with a keyboard four letters wide.

The starting sequence in mRNA looks like this.

atgtttgtttttcttgttttattgccactagtc ...

This message gets encoded by your own cells to build a protein out of amino acids.

atg = M = Methionine
ttt = F = Phenylalanine
gtt = V = Valine
ttt = F = Phenylalanine
ctt = L = Leucine
gtt = V = Valine
tta = L = Leucine
ttg = L = Leucine
cca = P = Proline
cta = L = Leucine
gtc = V = Valine
...

This is, of course, just the beginning of a longer sequence that eventually forms the dagger that punches into your chest. Here is the complete sequence. Or you may prefer the graphical version.

And finally, “rolled in fat and sprinkled with sugar and salt”? It’s true. Look at the ingredient list for the Pfizer vaccine: A Breakdown of the Ingredients in the COVID Vaccines. Everything is there for a reason. The mRNA fragments are rolled into little fatty lipid cells to keep them safe. Salts help match the pH, and sugar stabilizes the shape.

And now the charm is nearly ready…

Double, double toil and trouble;
Fire burn and cauldron bubble

UPDATE: I made a guess here as to exactly what sequence they would use for the vaccine. But the actual sequence has now been published. See How Do You Spell Vaccine?

Find even more information here: Reverse Engineering the BioNTech/Pfizer Vaccine.